Blastocladiella emersonii clone report

Clone ID BeE30N08B03
Best BLASTX Match gb|AAI21950.1|
Function Description Unknown (protein for MGC:146321) [Xenopus tropicalis]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE30N08B03
TGCAGTACGGTCCGGAATCCCGGGTCGACCCCGCGTCCGCACACTTGACG
CAACCACCATGCCACGCGAATTGATCACCCTGCAGGCCGGCCAGTGCGGC
AACCAGATCGGCCACGAGTTCTGGAAACTGCTGTGCGCCGAGCACGGCAT
CTCGCCCGACGGGATCCTCGAGGACTTTGCGACCGAGGGCGGCGACCGCA
AGGACGTCTTCTTCTACCAGGCCGACGACGACCACTACATCCCGCGCGCG
CTGCTGCTCGACCTCGAGCCGCGCGTCATCAAAAACATCATGCAGTCGCC
CTACGCCAACCTCTACAACCCCGAGAACCTGTTCCACACCAAGAGCGACG
GCGGCGGTGCGGGCAACAACTGGGCGCAGGGCCACTACCACACCGAGAGC
CTGTTCGAGGACATCATCGAGATGATCGACCGCGAGGCCGACGGGTCCGA
CTCGCTCGAGGGGTTCATGCTGCTGCACTCGATCGCCGGCGGCACCGGGT
CGGGCATGGGGTCGAACCTGCTCGAGAAGCTCAGCGACCGCTTCCCCAAG
AAGCTCGTCCAGACGTACAGCGTGTTCCCGAGCCACAGCGAGAACAGCGA
CGTGGTCGTGCAGCCGTACAACGCCATCCTGACCCTCAAGCGCCTCACGC
TGTACGCCGACTCGGTCGTCGTCCTCGACAACGACGCGCTCGACCGCATC
GCCACCGACATGCTGCGTGAGCAG
    




The gene BeE30N08B03 is related to E30-NOR-08-B03-U.AB1 ():

Sequence ID Image
E30-NOR-08-B03-U.AB1
No Image