Blastocladiella emersonii clone report

Clone ID BeE30N08A05
Best BLASTX Match ref|XP_746704.1|
Function Description small nucleolar ribonucleoprotein complex subunit [Aspergillus fumigatus Af293]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE30N08A05
GAACCACCCCCACTTGCTGCAATGAACTCGAGCGCCGTTGTCGCGCGCCG
CAACGATGGACCCGGGTCCAGTCTCGTCGCCGGTGGACCGGGGGCGGCCG
GCACGCTGATCCGCACCGAGGCGCCGCGGACATCCAAGCTGCTCGCCCCC
ATCATGCGGCTCGACGGGCACGACGGCGAGGTGTTTTCCGTGAAATTCTC
GTCCACGGGCGAGCATCTCGCGAGTTGCTCGTTTGACCGGAAAATCCTGC
TCTGGGACGTGTACGGCGAGTGCAAGAACTGGGGGATGCTCGAGGGCCAC
AGCAACGCGGTGCTTGACCTCGAGTGGTCGCGCGACAACAGGGAGCTGTA
CTCGGCGTCGGCCGACCACACCATCGCCGTGTGGGACGTGGAGACGGGCG
CGCGCGTGCGCCGCGGCAAGGGCCACACGGGGCTCGTGTCCTCGCTCGTC
CGCACGCGCCGCGGCCACGAGCTGCTGGTGAGCGGGTCCGACGACGGGTC
GTGCAAGGTGTGGGACCCGCGGTCCAAGCACGCCGTCGACGACCTCGCCA
CGGGGCTCCCCGTCACGGCGCTCGCGTGCTCCGAGACCGCCCGACTCGTG
TTCACGGGCAGCGTCGACAACCTCGTCA
    




The gene BeE30N08A05 is related to E30-NOR-08-A05-U.AB1 ():

Sequence ID Image
E30-NOR-08-A05-U.AB1
No Image