Blastocladiella emersonii clone report

Clone ID BeE30N08A02
Best BLASTX Match ref|ZP_01396671.1|
Function Description conserved hypothetical protein [Maricaulis maris MCS10]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE30N08A02
TTCCCTTATCATGAGAAAAAATGACCCGGCGCTGGTCCACGGCGCCTTTG
CGCTCTTTTCCCCCCGCTCATGCCCGCGTGGCTCCTCGCCCTCTTCTTCC
CGCGGGCGACCCTCACGCGCCGCCTCCTGCTCGCGTACCAGGCCGTGCTC
GCCAGCGTGTACATCTGGCAGGCCGTGTCGCTCATCTTTGAGGCCGCCCC
GCCGGGCGTCACCGGTCTCCTCGGCTCGAGCTACGTGCTGACGAGCATCG
ACCTGTTCACGCTGCCCGGGATCGTGAGCTTCTTCCACGTCGCGGCCGAC
CACCAGGTGGCCGCCGCGTGGCAGCACTACCTGGCGTTTGACCTGTTCGT
CGGGTGGTCGATTGCACGCGACGCCGAGATCGTCGGCATCTCCAAGTTTA
TCGTCGCACCGTGCATGTTCTTCACCCTCATGCTCGGGCCCACGGGCGTC
GGCATGTACCTCCTCGCCAAGCTCGCGCTCGGCAAGTTTGGCGTCAAGGG
GCAGGCGTTGTTCTGAGGAGTGAGGTGCGCGTAGCGCGCGGCTCGAGTGT
AAAGTACAACTGTTTCCTTGTAANCCCANCACCCAACACAACACAATCAC
NACACACAATACCAACCTCCCACACT
    




The gene BeE30N08A02 is related to E30-NOR-08-A02-U.AB1 ():

Sequence ID Image
E30-NOR-08-A02-U.AB1
No Image