Blastocladiella emersonii clone report

Clone ID BeE30N07H06
Best BLASTX Match gb|EAQ93348.1|
Function Description hypothetical protein CHGG_01583 [Chaetomium globosum CBS 148.51]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE30N07H06
GAGCGTGCATGCATCTGACTCCCTGCAACTCCCCTTGACCTATCATGGCG
TACCAGGGCGACAGCAAGATTGTGTTTGTGGGCAACATCCCGTTCGACCG
GACCGAGGACGAGCTGGCCGAGCTGTTCAGCCAGGCGGGCCCGCTGGTCT
CGTTCCGCCTGCTCATCGACAAGGACGCGCTGAAGCCGCGCGGGTACGGG
TTCGCCGAGTACCACGACCACGAGACGGCCCGGTGCGCCGTGCGCAACCT
CAACGAGCACGACCTCGGCGGACGAAAGCTGCGCGTCAACTTTGCCGACG
ACCCCAACACCCAGAGCGTGAGCGCCGGCGGCAACTATGTGGGTGGGAGC
AGTAACGCGAACAGGGATAACAATTCGCCGATGCCGCCACGGTCCGGCAC
GCCGCAGCCGCTGAAGCGGGAACCCGAGCCGGCGCCCGCACCAGCGCCGT
CGGTCCCGTCGGTCGCCGGCACGCCGCTGCAGCCGGGCATGACCGCGACC
GACGCCATTTCCAAGGTGATTGACGCCATGCCCAAGGAGCAGAAGCTCGA
CATTCTGTCGCACCTCAAGACGCTCTCCCTGACGTACCCGGACCAAGCGC
GCGAGCTGCTCAACGCCAACCCGCAGCTGGCCTACAGCATCATGATGATC
ATGATGACGTGCGGTCTGGTTGACGCGCCCGCGATCCAGCGTAT
    




The gene BeE30N07H06 is related to E30-NOR-07-H06-U.AB1 ():

Sequence ID Image
E30-NOR-07-H06-U.AB1
No Image