Blastocladiella emersonii clone report

Clone ID BeE30N07H03
Best BLASTX Match gb|EAT86653.1|
Function Description hypothetical protein SNOG_05589 [Phaeosphaeria nodorum SN15]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE30N07H03
GGTCACCTGCAGGTACGGTCCGGAATCCCGGGTCGACCACGCGTCCGCGG
ACGCGCGGGGGACATCCCTGTACCACCCACCCATCCAAGAGACCATGTCG
GACAACGTTGCCCATGCCGTCGCCGGCGCCGCCGGTGGCATCGTGTCCAC
GGTCGCCACCTACCCGCTCATCACCATCAGCAGCCGCCAGGCCGCGGCCA
AGAAGGGCGGCGACAAGGCCGACGAGTACAAGTCGTTCCTCGACGGCTGC
CGCAAGATCGTCAAGTCCGAGGGCGTCGCCGGCCTCTACTCGGGCATCAA
CTCGGCCATCTTCGGCATCGCCGTCACCAACTTTGTCTACTACGGCGCCT
ACGAGACCACCAAGTCGGGCTTCCTCAAGACCTCGGGCCGCCGCGTCATG
TCGACCATCGAGTCCATGGTCGCCGGCGCCATCGCCGGGTCGGCCACGGT
CCTCGTCACCAACCCCATCTGGGTCGTCAACACCCGCATGACCGTCAAGA
AGGACGCCAGCGACGACACGGCCTCCTCGTCGTCGGGCGCCCTCAAGAAG
AAGCAGGCCGCCACGGCCTGGGACACGTTCCTGGCCATCATCCGCGACGA
GGGCCCGACCGCCCTGTGGAAGGGACTTCTCCCCGCCCTCATTCTTGTCT
CGAACCCGGTCTTGCAGTTCAGTGTATTCGAGCAGACGCGCGGTCGCCTG
GAAAAGTACGCCCGCACGCGAACG
    




The gene BeE30N07H03 is related to E30-NOR-07-H03-U.AB1 ():

Sequence ID Image
E30-NOR-07-H03-U.AB1
No Image