Blastocladiella emersonii clone report

Clone ID BeE30N07H02
Best BLASTX Match ref|XP_793308.1|
Function Description PREDICTED: hypothetical protein XP_788215 [Strongylocentrotus purpuratus]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE30N07H02
CCCGCGTCCGCACAAGCACACGCAACTGCATGAAATCACCATGGACCGTC
AGGCTGTCGCTCTTGCAGTGGTTTATGTCACGTTTGCGGCGGTTTTAGTC
GCGTTGTACCAACAGCAGCAGCTCGCACTCAAGGTGCGCCGGCCCAAGCC
CACGGGTCGGCAGCAGTGGCGCCAGGGACCATTTGAACTCGACGAGCATG
ACGACAGAGACTGCTGGGCCAAATTTCGCTTTCAACGCGACGATATTCGA
TACCTTGCTTTTCGCCTACTCCCTGGAGACGTGCGAATCGACAACAACAC
GGTCGTGCCTCGCATCGAAGCCCTATGTATCCTCCTACGGCGCCTCGCGT
ACCCTTGTCGCCTTGGAGATTTGTGCCTCATCTTTCCACGCGACGCGACA
ACGCTTTCGCGTGTCGTGAACGAGGTCCTACGGATTCTCATCAACCGTTG
GATGCACCTCTTGACAATCAGGCCCCAAGCTTACCCGCCCCGCGTGCTTC
ATGCTTTTTCAACGGCCATCCATCAAGCAGGTGCTCCAATGACCAACTGC
TTTGGCTTTCTTGATGGGACAATTCGCAAGGTTGCTCGGCCTGGCGGACA
CAATGCTGTTCAACGGATTCTCTACACGGGCCAAAAACGGATCCACGGTC
TCAAGATGCAAGGTGTTGTCGCGCCGAATGGACTCTTCATT
    




The gene BeE30N07H02 is related to E30-NOR-07-H02-U.AB1 ():

Sequence ID Image
E30-NOR-07-H02-U.AB1
No Image