Blastocladiella emersonii clone report

Clone ID BeE30N07G12
Best BLASTX Match ref|NP_179037.2|
Function Description PIP; aminopeptidase/ catalytic/ hydrolase/ prolyl aminopeptidase [Arabidopsis thaliana]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE30N07G12
GTGCCTCTCGGAGAACACGACGCAGGCGTCTACCGTATCATCCTCCTTGA
CCAGCGCGGTGCTGGTAAGTCGACTCCCGCCGCGTGCCTCGAGGAGAACA
CGACGCAGGCGCTGGTGGCCGACGTCGAGAAGCTGCGCCTGCACCTGCAG
GTGGACCGGTGGGTCGTGTTCGGCGGGTCGTGGGGCAGCACGCTCGCGCT
GGCGTACGCGCAGGCGTTCCCGGACCGCGTCAAGGCGCTGATCCTGCGCG
GCATCTTCACGGTGCGCCGGTCCGAGCTCGAGTGGCTGTACGAGAAGGGC
GGCGCCGAGCAGATCTACCCCGACGCCTGGGACAACTACGTCGCGCCCAT
CCCCGAGGCCGAGCGCGGCGACCTCATTAACGCCTACTACAAGCGCCTCA
CGGGCACCGACGAGGCCGAGAAGCTCAAGTGCGCCAAGGCCTGGTCCGCC
TGGGAGATGTCGACGTCGCGCCTCGTGCTCGACCCCGCCGTCGTCAAGAA
GGTCGAGGAGGACATCTGGTCGCTGCAGTTTGCGCGCATCGAGTGCCACT
ACTTCGTCAACAGCGGCTTCATGCCCGACAACCACATTCTCGACTCGGTC
GACAAGATCCGCCACATCCCGTGCACGATCGTGCAGGGCCGGTACGACGT
G
    




The gene BeE30N07G12 is related to E30-NOR-07-G12-U.AB1 ():

Sequence ID Image
E30-NOR-07-G12-U.AB1
No Image