Blastocladiella emersonii clone report

Clone ID BeE30N07D12
Best BLASTX Match ref|XP_759155.1|
Function Description hypothetical protein UM03008.1 [Ustilago maydis 521]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE30N07D12
ACCATGTCTGCCGTGATCCCGTTCCTGCCCGACGTGCCGCTGCCGCTGGT
GCTGGCGGTGCTGTTCGGGTCGCTGGGCGCCATCGTGTTCCTGCGGCGCC
ACACCCCCACCCCGGCCCCCACCGCTTCGGCCTCCTCCGCTCCCGCTCCC
GCACGCACGACCGAGGAGAAGCCCAAGACCAAGCCGACGCCCGCCGCGAC
TCCCAGCAACAACGACGAGAAGAAGAAGCAGACCATGACGACGACCGCCG
CCGAGCCCCAGTCCGCGCCCGCGCCCACGTCGCAGCTGCAGCTGACGGCG
GCCGAGCTGGCCAAGTACGACAACCACGACGCGAGCCTGCCCGTGTACGT
GGCCATCAAGGGGACCATCTTCGACGTGTCGTCGAACCGCGCCATGTACC
CGCACAACGAGGCGTACGGCCAGTTTGCCGGCAAGGACGCGTCGCGCGCG
CTCGCCAAGTCTTCGCTCAACAAGGCCGACTGCGTCGCGACGTGGGAGGA
TCTGCCGCCCGAGGAGCTCAAGGTGCTTGACGACTGGCTTGCCTTCTACA
CGAAAAAGTACCCGATCGTCGGCAAGGTCGTCACCGAGTAGGTGTGACGA
GTGGGCGTGTGTCTCTGTGTCCGGTAGCTTCACATGACTGTTTATTGCGC
    




The gene BeE30N07D12 is related to E30-NOR-07-D12-U.AB1 ():

Sequence ID Image
E30-NOR-07-D12-U.AB1
No Image