Blastocladiella emersonii clone report

Clone ID BeE30N07D04
Best BLASTX Match ref|XP_760216.1|
Function Description hypothetical protein UM04069.1 [Ustilago maydis 521]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE30N07D04
CACGCGTCCGGGACCGGTCCCGGCGCACCGAGTGGGGGTTCCTGCTGCTC
GACGAGGTGCACGTCACGCCGGCCTAGCTGTTCCGCCGCGTGGTGAGCGA
CGTCAAGTCGCACACCAAGCTCGGGCTCACGGCGACGCTGGTGCGCGAGG
ACGGGCTGATCGAGGACCTCAACTACCTGATCGGGCCCAAGCTGTACGAG
GCCAACTGGATGGACCTGTCGGCGCAGGGCCACATTGCGCGCGTGCAGTG
CGCCGAGGTGTGGTGCGACATGACGCCCGAGTTCTTCCTCGAGTACATGG
TCACGGAGCCGCGCCGCAAGCAGGTCCTGTACGCCATGAACCCCAACAAG
TTCCAGGCGTGCCAGTTCCTCATCGACTTCCACGAGCGCCGAGGGGACAA
GATCATTGTCTTCTCCGACAACGTGTACGCGCTGCGCTCCTACGCCGTCG
CCATGGGGAAGCCGTACATTTACGGTAAGACGGGCCAACTCGAGCGCGAG
CAGGTCCTGCAGGCGTTCCAGAACGACCCGCGGCACAGCACCATCTTCCT
CAGCAAGGTCGGCGACACGTCGATCGACCTGCCCGAGGCGACGTGCCTGA
TCCAGATCTCGTCGCACTACGGCTCGCGCCGCCAGGAAGCGCAGCGCCTG
GGCCGCATCCTGCGCGCCAAGCGGCGCAACGACGAAGGGTTCAACGCCTT
CTTCTACTCGCTCGT
    




The gene BeE30N07D04 is related to E30-NOR-07-D04-U.AB1 ():

Sequence ID Image
E30-NOR-07-D04-U.AB1
No Image