Blastocladiella emersonii clone report

Clone ID BeE30N07C10
Best BLASTX Match ref|YP_143050.1|
Function Description unknown [Acanthamoeba polyphaga mimivirus]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE30N07C10
CACGCGTCCGGAGCAAAACGGGCACCTCGCCGTGCTCGACTGGTGGTACT
CGCACCGCGACTCGCTCGCGCTCACGTACAACAACCGCACCATCGACGCG
GCGAGCACCGAGGGCCGCGTGGCCGTGCTCGACTGGTGGCTCGCGCGGCG
CCGCGAGCTCAAGCCCGAGTACTCGAACTACGCCATCAACGAGGCCAGCA
TCCGCGGGTGCATCGCGTCGCTCGACTGGTGGTTCGCGCACCGTGGCGCG
CTGCGGCCAAGGTACTCGACGGCCGCGCTCGACGAGGCGTGTACCCGCGG
GATCGCGCGGTCGGTCGAGTGGTGGTTCGCGCACCGCGACAAGCTGCCGC
TTAAGTACACGGCGTTCGCCATGGATAACGCGAGCAGGCGCGGCCACGTC
GCGGTCCTCGAGATCTGGCTCAAGCACCGCGATGCCGTCGAGCTCAAGTA
CTCGCAGCAGGCCATGAACGACGCTGCGGCGCGCGGGCACGTCAACCTGC
TCGAGTGGTGGCGCGCGTCCGGGTTGCCGCTCAAGTTCTCGCCGGCCGGG
ATGCAGGAGACTCGCGTCAACGCGGTGCGCGAGTGGTACGCGCAGCACGA
GGCCGAGTTGCTTGCCCGACGTGTCGATACGG
    




The gene BeE30N07C10 is related to E30-NOR-07-C10-U.AB1 ():

Sequence ID Image
E30-NOR-07-C10-U.AB1
No Image