Blastocladiella emersonii clone report

Clone ID BeE30N07B03
Best BLASTX Match ref|XP_364166.1|
Function Description hypothetical protein MG09011.4 [Magnaporthe grisea 70-15]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE30N07B03
TCCGGGTCGACCACGCGTCCGGTCGCTCTTGGCGCCACGAAACTCGCCAT
GTCCCCGCTCGCCGCGTACCGCGAGTTCCTGCTGCACACGCGGCGCAGAT
CAGCTCGGTCGAGAGCGCGCTGCGGTCGCTGTCGTACTTTCTGCCCGGCC
GGTTCGCCGACGCCGACCTGGCCTCGGAAGCCCTGTATGCGGTCGTCAAC
CTCGTGTCGCTGTACCACGACCGCGTGCTGTACGACGCGGTGCGCGGGGC
GGGCATCGACCACAAGCCGGCGCTCGTCAACCAATACCACCGGTACTGGC
ACGCGGCCTCGCCCGCGGTCCACTACGCGTCCACGGCGCTCACGCTCGTC
CAGACCGTCGAGAGCGTGTGCGAGATGGCCGCCGCGAAACGGTGGTCCGA
GCGCCGGCGCTGGGATGTCGTGGCCGGGATCGAGGCGCTCAAAG
    




The gene BeE30N07B03 is related to E30-NOR-07-B03-U.AB1 ():

Sequence ID Image
E30-NOR-07-B03-U.AB1
No Image