Blastocladiella emersonii clone report

Clone ID BeE30N06E01
Best BLASTX Match ref|YP_680157.1|
Function Description amino acid transport protein [Cytophaga hutchinsonii ATCC 33406]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE30N06E01
CGTACACGTATCCACCATGGTCGCAAATCTCTTTGTCCGCAAGAGTGTCG
AGGACATCCAGGCCGACGCCGCCAAGACCGGCCTGCGCCGCAGTCTGACC
GGCCTCGACCTCATGCTGCTCGGTATCGGCGAGATCATCGGCGCCGGCAT
CTTCGTCATCACGGGTCGCGCCGCCCGCAACTTCGCTGGCCCCGGCATTA
TCCTCTCTTTCGTCATCTCGGGTATCGCCTGTGCATTTGCCGGTCTCTGC
TACTCGGAGCTCTCGTCCATTGTCCCCTCGTCTGGTTCCGCGTACATGTA
CGCCTACGCCGCTGTCGGCGAGGTCTTTGCGTTCCTGGTTGGGTGGGACC
TCATGCTCGAGTACCTCGTCGGCGCCGCCACCGTGGCCGTCGGATGGAGT
GCCTACCTGCTGTCGCTGCTCGCCGTCATCACCGGCACCGAAAAGTTCAG
CACCACATGGACCGCCGCCCCGTGGCAGATTGACGAGGACACGGGCGCCG
TCATTTCGGGTGCCGGGTGCGCGACGTGCGGTGTCGTCAACCTCCCCGCC
ATCGCCATCTCCATCTTCTGCACCATCATCCTCTCGATTGGTATCCGTCA
GTCGGCCATCGTCAACCACACCCTCGTCGTCATCAAGGTCGCCACCGTCC
TCCTGTTNCTGTTCG
    




The gene BeE30N06E01 is related to E30-NOR-06-E01-U.AB1 ():

Sequence ID Image
E30-NOR-06-E01-U.AB1
No Image