Blastocladiella emersonii clone report

Clone ID BeE30N06B07
Best BLASTX Match ref|XP_788025.1|
Function Description PREDICTED: similar to protein (peptidyl-prolyl cis/trans isomerase) NIMA-interacting 1 [Strongylocentrotus purpuratus]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE30N06B07
CGAATCGCCCACCATGAGCTCCGCCGACCAGCCGACCGACCTGCCCGCGC
CGTGGGAGCAGCGCATGTCGACGACCAAGAACAAGCTGTACTACTACAAC
CCGGAGACGCGCGTGAGCCAGTGGGAGCGGCCCGTGGGCGACGCGCAGAC
CCCGCGCGACGGCGAGATCCGCGCGTCGCACCTGCTCGTCAAGCACCGCG
ACTCGCGCCGCCCGTCGTCGTGGCGCAACGAGGCCATCACGCTGACCTAC
GACGAGGCGCTCGCCCAGATCGAGACCCACCGCGCCCGCATCGTTGCGGG
GGAGACCGACCTCCCGACGCTCGCCCGCACCGAGTCCGACTGCTCGTCGG
CGCGCACCGGCGGCGACCTCGGCTTCTTCTCCCGCGGCAAGATGCAGAAG
CCGTTCGAGGACGCGGCGTTTGCCCTCCAGGTCGGCGAGCTCAGCGGGCC
CGTCTCGACGGATTCGGGCGTGCACCTGATTCTGCGCACCGCTTGAGTTG
AGAAGAGAAATGTACACAGTTGGTTTANG
    




The gene BeE30N06B07 is related to E30-NOR-06-B07-U.AB1 ():

Sequence ID Image
E30-NOR-06-B07-U.AB1
No Image