Blastocladiella emersonii clone report

Clone ID BeE30N05G11
Best BLASTX Match gb|EAT33443.1|
Function Description signalosome subunit [Aedes aegypti]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE30N05G11
AGCGCAACCAGTCTATGAAACATGTCTGCCGAGGCCGGTCTTGAGTTTTC
CGTCCACCCGCTGGTGCTCCTCAACATCTCGGACCACTACAACCGTGGTC
GCGTCCAGCGCCAGGACTTTGCCGGGCTCGTGTTTGGCGCGCTCATGGGC
GTGCAGTCGGGCCGCCATGCCGAGATCTTCACGTCGTTCGAGGTCAAGGT
GACGCCCGACGAGTCGCGCGAGAACTGGGTCCTTGACACGGAGCTGTTTG
CGACGCGTCTCAACCAGTACAAGACCGTGTTCCCCGAGTACGATTTCCTC
GGGTGGTACTCGACGCACAGCCAGTCGCCGAGCGCGCGCGAGCTGGCGAT
CCACGCGCAGTTCATGCAGTTCAACGAGCTGCCCATCTACGCGCGGCTGG
ACCCGACCATGATGGGCGGCAGCAAGCACCTGCCGTTCTACGTGTACGAG
GCGTCCATCGACCCCAACTCGGGCAGCGCGGTGCTGGCCGAGTCGCCCGT
CAAGGTGGTGACGAGCGAGCCCGAGCGCATTGCCGTGGACGGCGTGGCCA
AGGACACGAGCGCGGCGGCGGGCGCCGAGGGCGCCGTGATCGCGCACCTG
TCGTCGCAGCGCAACGCGCTCGACATGCTGCGCCTGCGCATCAAAGCGCT
GCACGCGTACGTGGGACGCGTGCGCCGCGGCGACG
    




The gene BeE30N05G11 is related to E30-NOR-05-G11-U.AB1 ():

Sequence ID Image
E30-NOR-05-G11-U.AB1
No Image