Blastocladiella emersonii clone report

Clone ID BeE30N05E04
Best BLASTX Match gb|AAP83351.1|
Function Description succinyl-CoA synthetase, beta subunit [Neocallimastix patriciarum]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE30N05E04
CCGGCAAGCCCTGCAACACCGTCTACGTCGTCGAGCGCCTCTACCCGCGC
CGCGAATACTACTTTGCCATCCTCATGGACCGCAAGTACCAGGGCCCCGT
CCTCGTCGGCTCCAACCAGGGTGGTGTCGACATCGAGACCGTCGCCGCTG
CCACCCCCGACGCCATCAAGACCATGCCCATCGACATCCAGACCGGTCTG
TCGCGCGAGCAGGCCCGCCAGTTTGCCCGCGACATGGGCTTCCCGACCAA
GGCCGTCGACGACGCCGCCGAGACCTTCATCAAGCTCTACGACGTGTTCA
TCTCCAAGGACGCCACCATGGTCGAGATCAACCCCCTCGCCGAGGTCTCC
ACCGGCGAGGTCGTGTGCATGGACGCCAAGGTCTCGTTCGACGACAACGC
CGACTTCCGCCAGGCCGACGTGTTCCAGCTCCGCGACACGACCCAGGAGG
ACCCGCGCGAGGTCAAGGCCGCCGAGGCCAAGCTCAACTACATTGGCCTC
GACGGCAACATTGGCTGCCTCGTCAACGGCGCCGGCCTCGCCATGGCCAC
CATGGACATCATCAAGCTCAACGGCGGCGACCCCGCCAACTTCCTCGACG
TCGGCGGCTCCGCCACCACCCAGCAGGTGACCGACGCCTTC
    




The gene BeE30N05E04 is related to E30-NOR-05-E04-U.AB1 ():

Sequence ID Image
E30-NOR-05-E04-U.AB1
No Image