Blastocladiella emersonii clone report

Clone ID BeE30N05D09
Best BLASTX Match gb|AAW42317.1|
Function Description adrenoleukodystrophy protein, putative [Cryptococcus neoformans var. neoformans JEC21]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE30N05D09
CAGAACGTCGATTACATTCCCATCTCCGACCACCGACACGATTGCAGCAC
GCAATCGCACGCACACTCCACCACCGCTTAGAGCGACGCGGAGCTCGACG
GCGCGCTCTCGAACCGCTCGGCGTGGATCGAGCGGAGCTCGTCGAGGCGC
GACTTGAGCTTGCTCTCCTCCTGGAGCAGGCACTCGAGGCGCGTCTTCTC
CTCCTGGAGGGCGAGCCGCTTCTCGGGGTCGAGGTCCGTGAACACGTACC
CGCCCATGCCGTCGAGCTGGAGGATCTTGGAGTGGTACTGCCAGACGGTG
GGCCGGTGCGCGATCGTGATCATGGTGATGCCGAGCTCCTTGGCGTGCTG
GTACATGATTTGCTCGACAACGACATTTGTAACGGAAGTACTTTCGTCGA
GAATCGCGTACTTGGGCTTGTGGTAGAAGAGCCGCGCGCCCGCGAGCCGC
TGCTTGTCGCCGCCGGCGAGCGTCGACGACCACTCCTTGACGGCGTCCCA
CCCGCCCTCGCGCTCGACGAGCGTGTCGAGCTGCATCACCTCGAGGATCG
CCTGCAGGTCCGCGTCGGTGACGCCGCGTGCGCGCATCTCGGCGTGCGTG
TGCGGGTAGATGACCTGGTCGCGCAGCGTGCCGGTGC
    




The gene BeE30N05D09 is related to E30-NOR-05-D09-U.AB1 ():

Sequence ID Image
E30-NOR-05-D09-U.AB1
No Image