Blastocladiella emersonii clone report

Clone ID BeE30N05C04
Best BLASTX Match ref|NP_001029575.1|
Function Description hypothetical protein LOC511378 [Bos taurus]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE30N05C04
GCAACCGCCCCACTTCCATGCACACAGGCTAGACGCGCGACTCGCCGCAA
CGCAACCATGTCGACGGACCTGACCAAACGCCCCACGCACCCGCTCCGCC
CGTTCGCCGCGCGGCCCGCCGACGCCGTCTTCTTCGGCTACTTTGCGAGC
CACATTGGCTTCTCGCTCGTCATGGACTTCCAGGCGGCGCTCGACGGGCT
CGTCACGTACCCGTGGCCGCTGCGCGGGCTGCACAGCTGGTACATCAAGG
TATCAGGCGACCCGCTCATGGGCAACCCGTCGGCGGCGCACCACCGGTGG
TTCAAGGCGTTCCTCGTGTGCGAGCTGCTCGTCCAGTTCCCGTTCTTCTT
CCTCGCCAGTCGGCGTATCTACGACGACCGCGTGGGCGATCGCACCCGCG
CGCTGCTGATCGCGTACGGCGCGCACGTCGCGACGACCATGGTGCCCGTG
CTCGACGCGCTGGTGACGACTGACGCCGTCACGCCCATCCAGCGCGCCGG
CTTGTTGGGGGTGTACATCCCGTACCTCGCGGTCCCCGCCGCCCTCGTCT
GGCACTACGGGTGGAAGTGGGCCAGCTACACCAAGAAGCGCGCCGCGTAT
GCTGCGCGGAAGGGCGGATAGGCGAAGTGGTGAGGGTCGTCNAGCGGTTT
TGATGGACACGGATGACGAGCAGCGAGGGAGAAGCANAACTTTTATGAGC
ANCATACAGGACTCCCACT
    




The gene BeE30N05C04 is related to E30-NOR-05-C04-U.AB1 ():

Sequence ID Image
E30-NOR-05-C04-U.AB1
No Image