Blastocladiella emersonii clone report

Clone ID BeE30N05C03.1
Best BLASTX Match ref|XP_639271.1|
Function Description hypothetical protein DDBDRAFT_0185276 [Dictyostelium discoideum AX4]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE30N05C03.1
AGGAGTAATATTTATTTATTTGAGCGGTTTCTTCAGTCGTCATCTGCGTC
GACCTTCTCGTCGTCACCGTCCTTGCCGTCGCCCAGCGGCGCGTTGATGC
TCGAGTCCAACATGAGCGTGAGGCCGCCCGTCACCAAGGCGAGAAGCGAC
ATCACGTAAAAGATGAGGTGGTAGTCGAACGGCTCGGACGTCGAGTACAG
CGACAGCGAGAAGAGCGAGCCCGTCACGATCGGCGCAATGATGCGCGACA
GCGACGCGAACGCCTGGCCGAGCCCGTTCATCGCGCCGCGGTCCTTGGTG
AGCGTCGCGTTGCTGACCATCACGAACACGGACGTGAACGAGTTGGTCGC
GTTGATCTCGAACACGACCTGGAGCACGAGCAGCACGATGCGCGACCCCC
ACACCGTGTCGACGAGCCCGGGCACCAGCTGCGGGACCCGCGGGTACAGT
ATATGCACGGCGATCGGCACCAGCGTCCCGACGCGGTACACGGTCAGCGC
GCCGAACCGGCGCTCGAACGACGGGAACAGGACCAGCTGGTACGCCAGGT
TGATGGCGCCGCACACGCTC
    




The gene BeE30N05C03.1 is related to E30-NOR-05-C03-1.AB1 ():

Sequence ID Image
E30-NOR-05-C03-1.AB1
No Image