Blastocladiella emersonii clone report

Clone ID BeE30N05B03
Best BLASTX Match ref|XP_505426.1|
Function Description hypothetical protein [Yarrowia lipolytica]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE30N05B03
GCCGGCCTCGCTCACCTTCCCCGCGCCGCCGCCGCCGCGCATCGCCATGC
CCGCGCAGAGCATGAAACTCGAGAGCGAGCTCAACCCGCCCGACGTGTCC
GACTCGCTGCACCTCGAGGAGCTCGACAAGAACCTGTACCGCGTCGCGCC
CGCCGCGCTCTGGCGGCCCGTCGGCGCGCGCGGCGTGTTTGGTGGGCAAA
TCATTGGTTTAGCGCTTGTCGCAGCTACGAACACGGTCCCGGCGCCGTTC
AAGGTGCACTCGCTGCACAGCTACTTCCTGCTCGGCGGCGACAACACGCG
CGCCATCGTGTTCCACGTCACGCCGATGCGCGACTCGCGCTCGTTCGTCA
CGCGCCAGGTCACGGCCCAGCAGAACGGCCGGCCCATCTTCATCATGGTG
TGCAGCTTCATGCGCCGCGAGGCGTCGCCGCTCGAGCACCAGTACACGAT
GCCGCCCGCGCACGCTCGCCGTGACGTGCGCGCAGGAGGGCCTGCTGCGC
GCCACGGTCGACCCCGAGAAGCCCATCACGGGCGGGCTCGGGTACCGCCG
CGTCAAGGACCTGCAGCGCACGCTCCTCGACCGCGACCAGAAGAAGCAGC
GCGACATGGAGAACGAGCAGGGCGAGCTCAGGCCAAGCTGTGAGCTGACT
GACCGTTGCGGACGGGATGGAAGGTGANGGGGACGGATTACTANCTGACT
GAC
    




The gene BeE30N05B03 is related to E30-NOR-05-B03-U.AB1 ():

Sequence ID Image
E30-NOR-05-B03-U.AB1
No Image