Blastocladiella emersonii clone report

Clone ID BeE30N04H04
Best BLASTX Match ref|ZP_00944036.1|
Function Description Hypothetical Protein RRSL_03724 [Ralstonia solanacearum UW551]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE30N04H04
CTCGACGCTCTCTGATCCAATGGAATTCGCGCGCCTCGCGCTTTCGCTTG
AGCTTCCCGAGGACTTTGTGGGCGTTGGCTCGGGCGAGATCTTCTCGGAC
GGCTCGCTCAAGGGCGCGGGCACCGACGCCGTGGCTGCTGGTGCAGGCGT
CTGCACAGTCGACCGCGAGGAGGACTTTGAGTGGAGTTTCGCAGTCCCTG
CCGGCAACCACTCAAGTTTCCGGTCCGAGCTCTGGGGCGTCATTGCGGCT
GCCTCGGTGGCCAGACGCGGGACCTCGCTCACCATCACTCTGGACAACAA
GGGTGTGGTCGACACCGCGGTCAAAATGCTTGCACCCAGCGCACGCGTCA
AGATCCGCGCAACGTGCTCGCTGGAATGGGCCGTGCTCCGTTGGATCGTG
GAGGCGCGCAACCTCAAGATAGCTTTGCAGTGGACGCGCGGGCACGTCGG
CACCAAGGGCAACGAGGTGGCGGACGGCCTGGCCAATTCAAGAACGCAGC
CCGGCGTCGCCCCTCTCGCCATCAACCCGGCGATCCGCCGGCTGTTTGAC
GCGCCCTTCACGGTGATGTGGCGCGGCCAGGCCATCAACACGGACCCGCG
ACGCTTTGCGCGCGGCCTCAACAACGCGCGGCACAACGCCGTGTTGGCGA
CCGTGACGGCGGCCGGCGTCGTGCGCGCTCCCGTTGACAT
    




The gene BeE30N04H04 is related to E30-NOR-04-H04-U.AB1 ():

Sequence ID Image
E30-NOR-04-H04-U.AB1
No Image