Blastocladiella emersonii clone report

Clone ID BeE30N04G11
Best BLASTX Match ref|XP_758718.1|
Function Description hypothetical protein UM02571.1 [Ustilago maydis 521]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE30N04G11
CCAGCACCCAACCATGTCTGCCGCCGCCGCACCCTCTGCGCCGTCCTCGG
GCGGCAACCAGGGCGGAACCTTCAAGGACAAGACCAAGCCCGAGGAGGTC
CGCAAGTCCAACATTGTGGCCGCCAAGGCCGTCTCGGACGCGGTCCGCAC
CAGTCTCGGCCCCCGCGGCATGGACAAGATGATCCAGACCGGCACCGGCG
AGGTGATCGTCACCAACGACGGCGCCACCATCCTCAAGCACATGAGCGTC
ATGCACCCCGCTGGTCGCATGCTCGTCGACCTGTCGGCTGCTCAGGACGT
CGAGGCCGGCGACGGCACCACGTCGGTGGTCGTGCTCGGCGGCTCGCTGC
TCAACGCGGCCGAGAAGATGCTGTCTAAGGGCATCCACCCGACCGTGATC
GCCGAGTCGTTCCAGGCCGCCGCCGGGAAGGCGGTCGAGATCCTGACCGC
CATGGCGACGCCCGTCGACCTGGCCGACCGCGAGTCCCTGCTGCGCGCCG
CGTCCACGTCGCTCAACTCCAAGGTCGTNGTCGCAGTACTCGTCGCTGCT
GTCCCCGATCGCCGTCGACGCGGTGCTGCGCGTCATTGACCCGGCCACGG
CCACCAACGTCGACCTGCGCGACGTGCGCCTCATCAAGAAGGTGG
    




The gene BeE30N04G11 is related to E30-NOR-04-G11-U.AB1 ():

Sequence ID Image
E30-NOR-04-G11-U.AB1
No Image