Blastocladiella emersonii clone report

Clone ID BeE30N04G06
Best BLASTX Match gb|AAX55641.1|
Function Description ferritin [Litopenaeus vannamei]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE30N04G06
CAACATGTCGCTCGCCCGCCAGAACTACGCCGCCGCCTCGGAGGAGGGGC
TCAACGTCCAGCTGAACATGGAGCTCAAGGCGTCGCACATTTACCTCAGC
ATGCATTCCTACTTCCAGAGGGCCGATCAGGCCCTCCCTGGACTGGCCAA
GTTCTTCAAAGTTTCTTCCGACGAGGAGCGCGAGCACGCCCAGATGATGA
TCGACTACATGAACATGCGCGGCGGCAAGGTGGTCCTGCAGTCGATTGTC
GCGCCCGAGGTCGAGTGGGGGTCGGCCAAGAACGCGGTCGAGTTCACCCT
CAACCTCGAGAAGGAGGTGCGTCGCTTCTCACCGCCCACATTCCCACCAG
CATGACGCTAACTATCCCGTCCGTCCGCTTCCTACAGGTCAACAAGGCGC
TCCTCAAGCTGCACGGCTTCGCCGACTCCAACTCGGACCCGCAGTTCTGC
GACTTCATCGAGGGCAACTTCCTCAACGAGCAGGTCGAGGCCATCAAGAA
GCTGTCCGACATGCTCACGCAGCTCAACCGCGTCGGCGCCGACGGCCTCG
GCCTGTACCTGTGGGACCAGGAGCTGCTCAAGTCGCTCGAGCACTAGGCC
CGCCCGCCCGCCTCGGCTGCCGTCGCCCGTGCGCGCGCGGCCATTGTACA
GTTTCTCGGTTTCTTTTAGCGTGATTTGATACAAAACCACGTTCTTCATC
    




The gene BeE30N04G06 is related to E30-NOR-04-G06-U.AB1 ():

Sequence ID Image
E30-NOR-04-G06-U.AB1
No Image