Blastocladiella emersonii clone report

Clone ID BeE30N04G04
Best BLASTX Match ref|XP_647212.1|
Function Description hypothetical protein DDB_0191260 [Dictyostelium discoideum AX4]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE30N04G04
AGCGCACCGACTCGCTGCAACGTATCATCACCAAACCATGTCACTCGGCC
GCAAACGAATCGACTTTGAGGCCGTCTTCACCGGGTTCATCCGGGTCGTC
GACCAGCTCTTCTCGTGCACCCCGAGCGACCCGGGCGCCGTCGTCGGCGG
CATGGACCTCTACGAGTCGGTGTACCAGATGTGCAACACGCGGCCCAAGC
CCATGGCCGAGGACCTGTTCCTGCGCCTCGCCGACTACCTCGCGCGGCAC
ACGCAGGAGATTGCCAAGCGCGTCCACGCCAGCGACCACGCGCTGCAGAC
GTACGCGGCCGAGTGGGAAATCTACCTGTTCGCGACGCAGACGCTCAACA
TCGTGTGCGACGTGCTCAACCGGTCCATCTGCACCCCGCTGCGCGGCGCC
AACATGAGCGTCGCGATGCGCGCGCACCAGGAGCGCCGCCCGCTCGTTCG
CGACAGCGTGTACAAGCGCCAGTCCGTCGAGAGCCTCGCCTTTGTGCTGT
GGAAGGACAACGTGTTCCGCAAGCTGCGCAAGGACCTGATCGGGTCCGTG
GCCGACGTGGTGCGCGGCGACCGCGAGGGCGTGCTCGGCCCGCACGAGGC
GTGCAAAGCGCTCGCCCTGTCGCTCGTCACCCTGCAGGCCCGCGTCTCGC
AGTCCATGTCGCTGTACCTCTACGACTAC
    




The gene BeE30N04G04 is related to E30-NOR-04-G04-U.AB1 ():

Sequence ID Image
E30-NOR-04-G04-U.AB1
No Image