Blastocladiella emersonii clone report

Clone ID BeE30N04F12
Best BLASTX Match emb|CAB16372.1|
Function Description SPAC2C4.12c [Schizosaccharomyces pombe]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE30N04F12
AGCTGACGCCGCTGACCGAGGCCGCGGGCAACATCCCGGCCGTGGCGGTG
CACGGCACGACGCGCGCGGCGTGGGCGCTCATCGCGCGCGACGGGCTGCG
GGTGATGCGGCGGCACCACGTGCACTGCGCCAAGGGCCTGCCGGGTGCGG
ACGGCGTTGTGTCGGGCATGCGGCGGTCGAGCGAGGTGCACGTCTACGTC
GACGTAGCGCGCGCCGTGCGCGACGGCATGTCCTGGTTCGAGAGTGCCAA
CGGCGTCGTGCTCTCGGCCGGGTTCGACGGCGTCATCCCGCCCAAGTACT
TTGCCCGCGTCACGGACGGACAGGGGCGGCCCATGTCCCTCGATGCGTAA
TACAACCGCAGTCCTGTGCGCCCATTATTCG
    




The gene BeE30N04F12 is related to E30-NOR-04-F12-U.AB1 ():

Sequence ID Image
E30-NOR-04-F12-U.AB1
No Image