Blastocladiella emersonii clone report

Clone ID BeE30N04F02
Best BLASTX Match ref|XP_382719.1|
Function Description hypothetical protein FG02543.1 [Gibberella zeae PH-1]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE30N04F02
CACACTGCCATGTACTCGATGCAACTGCGCGCACTCGCCGCGCGGACGAC
CTCGGCCGTCGCCGCGCGCACCGCCCTCCCCGCGGCAAGACCATGGACCG
CCGCGACGCTCAGCCCACTACGCTCGTTCGCCACGCGCATCGTGCGCCCC
GAGACCCCGTCAGTATCGCCCGACGGTAAGCCCATGTCGCTCGAGATTGA
CGCCTCGGCCGTCAAGCAACTCAAGAAGCTGTACGCGAGCGAGAACAACG
ACCAGCAGGCGCTGCGCATCATCGTCGAAGCCGGCGGGTGCCACGGCTTC
CAGTACAAGCTGGACCTGGTCGACGCGACCGCGCTCGAGCCCGAGGACGT
GCTGCTCGAGAACGACGGCGCCAAAGTCGTCATTGACGACACCTCGCTCG
AGCTCGTGTCGGGCTCCAAGGTCATCTTCGCCAACGAGCTCATTGGCCAG
GAGTTCCGCCTCACCGACAATCCGAACGCGGGCTCGAGCTGCGGGTGCGG
CACCTCGTTCGAAGTCAAGTTTTGACACTGCTCGCTCCTCTCCCCGAATA
CATAGACCAGTGATTACTCNNNNN
    




The gene BeE30N04F02 is related to E30-NOR-04-F02-U.AB1 ():

Sequence ID Image
E30-NOR-04-F02-U.AB1
No Image