Blastocladiella emersonii clone report

Clone ID BeE30N04E11
Best BLASTX Match gb|AAW45897.1|
Function Description integral membrane protein sed5, putative [Cryptococcus neoformans var. neoformans JEC21]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE30N04E11
CGGAACGCTACGCATCTCTACGAATCTCCACGCATCAAGCAACGCACCGA
ACCCACCATGGCGTCCCTCAAGGACCGCACCAACGAGCTACTGTCGGCGA
TGCAGACCATCGAGGGCCGCAGCATGGACCACCTGCGCCAGAAGCCCGGC
CCGAGTGGCCGCCCCGCCGCCAACGAGCTGAGCGCGCCGCTGCTCGGGTC
GTCCGCCGCCTCTTTACCGCCACCACAACAGCATCCGCGCGGCACGCGCC
CCAAGACCGAGTTCTCGCAGCGCGCGGGCTACATTGCGCGCGCCATCCAG
CAGACGGCCGCCAAGCTCGAGAAGCTCGGCAAGCTGGCCAAGCGCCGCAC
GCTGTTCGACGACCGGCCCGTCGAGATCGCCGAGCTGACCGCCGTCATCA
AGCAGGACATTACGGCGCTCAACACCGAGATCCGCGCCCTGCAGGCCCTC
TCGCAGGCCCACAACGCGCGGTCGCGCGCCGGCCAGCACGAGGAGGAACA
CTCCAAGTCGGTCGTCGTCGGCCTCCAGAGCAGCCTCGCCCGCGCCTCGC
AGGGGTTCGCCGAGGTCCTCGAGATCCGCACCGAGAACATGAAGGCCCAG
AAGGAGCGTCGCGACCAGTTTGCCG
    




The gene BeE30N04E11 is related to E30-NOR-04-E11-U.AB1 ():

Sequence ID Image
E30-NOR-04-E11-U.AB1
No Image