Blastocladiella emersonii clone report

Clone ID BeE30N04E03
Best BLASTX Match ref|XP_417337.1|
Function Description PREDICTED: similar to hypothetical protein [Gallus gallus]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE30N04E03
CGTGCTCGCCCTCACACTCTACCATATACGCTCCTCCTCTCGCCGCTGCC
CGGCTGCCGTGACGGTTGCGCGTTGCCCACTCGACACATCTAGCACACCT
GCTTCTTCACGATCACCACCATGGACTCGGTCACGCGCTTCATCCTCGAC
CCGGCCAACCGCGACCTGCTCGCGCTGGTCAAGGGCTTCCGCAATGGCAT
CGTCTACGGCGCCAAGGTGCGGTTCCCGCACGCGCTGGTCATGACGTTCC
TGTTCCGCGACGGCAGCCTGCGCAGCAAGTTCAAGTTCATCTTCGACGCG
ACGCGCCAGCACTCGTGGAACCTCGGCCGCTTCGTACTCATCTACAAGAC
GCTGCTGCTCGCGCTGCGCCGCGCCCGCGGCGGCAAGGAGTCGACCGCCG
ACGCCTTCCTCGCCGGCACCGTTGGCGGGTACCTCATCTTTGGCGCCAAC
AACAACATCAACCAGCAGATCGTCCTCTACCTCTTCTCGCGCATCATGAT
CGGCATGGCCAAGTACGCCGTCAAGGCCGAGATCGTGCCCTCGCCTGAGC
AGGACGTGTTCCCCGCCTTTGCCGCCGTCGTCTGGGGCATCGTCATGTGG
CTGTTCCGCCACCACCGCGACACGCTCCAGTCGTCGCTCCAGGCGTNCAT
GCAGTACCTCTACAACGACTCGGACGTCTGGAAGTCGCTCAAGACCCTNC
TGTGGCACAACNAAGTACTGGNCGTGTCNGCGCGTGTGGTANTACCGGAT
TGGGAATGAATACCCCATCATTGACCTANNAC
    




The gene BeE30N04E03 is related to E30-NOR-04-E03-U.AB1 ():

Sequence ID Image
E30-NOR-04-E03-U.AB1
No Image