Blastocladiella emersonii clone report

Clone ID BeE30N04B02
Best BLASTX Match gb|AAW43000.1|
Function Description protein-binding protein, putative [Cryptococcus neoformans var. neoformans JEC21]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE30N04B02
CCCCTATCGCGATGCATCTCTCCTCAGCTGCTGCAAAGCCTCTAACTTAC
CTCACGCAGCGCGCGGCGCAGGCCGTCGACGTCGAGCTCATGTCGGCTGC
GGGCGGCTTCTCGATTGACCAGCTCATGGAGCTCGCTGGCCTGAGTGTCG
CGCAGGCCGCCGTCCGCGTGTTCCCGCAGCCCGGCCCAGTGCTCGTCTGC
TGCGGCCCTGGCAACAACGGCGGCGATGGCCTCGTCGCGGCGCGCCACCT
CGTGCACTTTGGCTACTCGCCGACCGTGTACTACCCGAAGGTGAGCTCCA
AGCCGCTGTTTGTCGGTCTCGTGCGCCAGCTCGAGAACCTCGGCGTGCCC
TTCACCGGCGAGCCGCCGCTCAAGGTCGCGTTCGAGGCGGCTCTCGCGCG
GTCCGACTTTGTCATTGACGCGCTTTTCGGCTTCAGCTTCTCGGGTCCGA
TCCGCGCACCGTTCGACACGGCCATCGAGGCCATCAACGCGTCCGGCAAA
CCCGTCCTGTCGGTCGACATCCCGTCGGGCTGGGACGTAGAGCGCGGCCA
GGTCGACGCCGGCCAGGGCATCCGCTCGCCGCACGCGCTCATCTCGCTGA
CGGCGCCGAAACAGGGTGTCATCGGGTACACCGGCATCCACTACGTCGGC
GGTCGCTTCGTCCCGCCCGCGCTCGCGCACCGGTTCGGGCTCGTGCTCCC
GGCGTACCAGGCACGGATCAGGTTGTGCNGATCGCGTGAGGGAGTGTGTG
AAAGATGATATAGAGTGTATTAGTTGAATC
    




The gene BeE30N04B02 is related to E30-NOR-04-B02-U.AB1 ():

Sequence ID Image
E30-NOR-04-B02-U.AB1
No Image