Blastocladiella emersonii clone report

Clone ID BeE30N03E06
Best BLASTX Match ref|XP_647377.1|
Function Description hypothetical protein DDBDRAFT_0189610 [Dictyostelium discoideum AX4]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE30N03E06
CACAACCAACCCCATCCCACGCCAAGCAACGCATCGACCACCACCATGGA
CAAGGAAACCTCGCCTCTGCTCAGCAGCGGCACCCGCACACCAACGTCGC
CGCCGCGCCAGCGGCAGCCGCTGCTCACCGCGGCCGGCGCATCGTCATCG
GTCTCGCCGACAACATCGCCCGTGCCCGCCGCCGGGCTCGCGTCGTACGG
CAGCGACCACGACCATGAGGCCGCCAACGACTACGGCGACGACACGCACC
TGCTCTCGCCGACGGAGCGCGAGCGGCTGGCCAACGACACGACGATCCCG
CGGTCCGTCTACTTCATTGTCGGCAACGAGTTCTGCGAGCGGTTCGCCTT
CTACGGCATCAAGGCGGTCCTGTTCATCTACCTCACGCGGTACCTGCAGA
TCGGCTCCGACACGAGCACCGCCCTCGTCCACACCTTCACCATGGCCGCC
TACACGGCCACGCTGCTCGGCGGCGTCCTGTCCGACTCGTACCTCGGCCG
CTTCCGCACCATCCTGTACCTGTCGCTCGTCTACTGCGTCGGCAACCTGC
TGCTCTCCGTGACCGCCATCCCGGGCGTCATGAGCCGCCCAGCGACGGGG
TCCGTGTCGCCCATGGGCGCGTTCGCCGGCCTGACCCTNCTCGCCATCGG
CACG
    




The gene BeE30N03E06 is related to E30-NOR-03-E06-U.AB1 ():

Sequence ID Image
E30-NOR-03-E06-U.AB1
No Image