Blastocladiella emersonii clone report

Clone ID BeE30N03E01
Best BLASTX Match emb|CAG59402.1|
Function Description unnamed protein product [Candida glabrata CBS138]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE30N03E01
TCGCCATGTCAATGCTTCACCGACTCGCCGCCACCGCCGTCCCGCTCGGC
GCGCGGTCGCTGGCCTCGCAGGCCGCCGCTGCCGCTTCCGCCTCTTCGAC
GCTGACGATTGGCCTCATCGCCGGCGACGGTATCGGGCACGAGGTGATCC
CCGCCGCGCGCCGCGTCCTCGAGGCGCTGCCAGCGGCGCTCGGATCCTCG
GCGGCAGCAACGACCGTCCCGCAGTTCCGGTTCATCGACCTCGACGCGGG
CTTCGACACGTTCGAGCGCACGGGCAACTCGCTGCCGGACGCGACGGTGC
AGGCGCTGCGCACCGAGTGCCAGGGCGCGCTGTTTGGCGCCGTGAGCTCG
CCCATCCACAAGGTCGAGGGCTACACGTCGCCCATCGTCAAGCTGCGCAA
GGAGCTCGACCTCTACGCGAACGTGCGGCCCATCGCCAACCCGCGCGCCT
TCAACGCCCAGGGCAAGCCGGTCCCGTGCGACATTCTGATCGTGCGCGAG
AACACCGAGTGTCTCTACATCAAGCAGGAGCGCCTCGAGACGGATCCCGC
GACGGGCCTGCGCACGGCGTACGCGACGCGCCGCATCTCGGAGCGCGCGA
CCCAGCGCGTCGCCCGCGTCGCCTTCACCATGGGCCGCGCGCGCGCCGNC
GNGCGACCCGAAGG
    




The gene BeE30N03E01 is related to E30-NOR-03-E01-U.AB1 ():

Sequence ID Image
E30-NOR-03-E01-U.AB1
No Image