Blastocladiella emersonii clone report

Clone ID BeE30N03D09
Best BLASTX Match gb|AAW43590.1|
Function Description mitochondrion protein, putative [Cryptococcus neoformans var. neoformans JEC21]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE30N03D09
CAGCAGCCCACGACTTGCTGCAACCTAGACCACATCCATGAACCACCTCA
AGTCCCTGTTGCCGCGGGGCCTCGCCTTCACCCGCCTCACCGCTGCCGCC
TCCCCAAGTCGACCACCGCTGCTTATGCGTTCCATGGCGCAACTCGCCGC
GACCGCGCCGAAACGCGACCCGACGACACCTCCCGTGCTGATCCCCACCG
ACTCCTCCGCGCTTCCGCCGTCGTTCCCGCACGCGGCGGCGTTCCGGACG
TACGCGTCGGCGGCGCTGGTGGCCTCGGCGACGCCGCAGTCGCACCGGTT
CGACACGTACCGCATGGTGACGTACCTCGAGTCGCGCGGGTTCACGCGCG
GCCAGGCGGTGATTGTGATGCGCACCATGAACGAGCTGCTCGCCGACGCA
GTGCACCGCGCGTACGGCGAGATGGTGAGTCGGACTGATGTCGAGAACGA
AACGTACCTGACGAAAGCCGCGCTGGCCGAGCTGGGCACCGAGCTCAAGA
TGCTGCGGCAGAACGACCACGCGGCGCTGCAGTCCGAGATCGACGCGATT
GCGCGGGACCTCGAGGTGCTGCAGCAACGCGGGCGCGACGACATTGCGAC
CATCAAGAGTGACATTACCATCGACCTCAACAACCGCAGTCCGAGATCCG
CGAGGAGGGGCAGGTCATGGACATGCGCATCCAGNAGGGT
    




The gene BeE30N03D09 is related to E30-NOR-03-D09-U.AB1 ():

Sequence ID Image
E30-NOR-03-D09-U.AB1
No Image