Blastocladiella emersonii clone report

Clone ID BeE30N03D06
Best BLASTX Match ref|XP_419840.1|
Function Description PREDICTED: similar to ACY1L2 protein [Gallus gallus]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE30N03D06
CTCCGCTCGTCTGCGGCTCTTTGGCACGCCGGGCGAGGAGGGCCTCGGCG
GGAAGATCCACATGATCAACGCGGGCGACATGACCGGGGTCAACTTCTAC
CTGATGCTGCACCCGGGCAACATTGACCTCGCGTTCCCGACGTACCTCGC
ACACCAGGCGTTTGACGTCGAGTACTACGGCCGCGAGGCGCACGCGTCGG
GCGCGCCGTGGGAGGGCATCAACGCGCTCGACGCCATGATCAACGCGCTC
AACGGGATCGCGCACCTGCGGCAGCAGATCACGCCGACGGACCGGATCCA
CGGCATCATCCGCAACGGCGGCGCCGCGCCCAACATCATCCCGGCGCTCA
CGACGGGGACCATCAAGGCGCGCTCGCTCACAACCACGCACCTCCGCACG
TTCCTCCTGCCCAAGGTCCTCGCGTGCGTCGAGGCCGGCGCACGCAGCGC
CGGGTGCACGTACCGCGTCGACATGATGCTGCCGTACTTTGACGTGAACA
CGAACGCCGCCATGGCGCGCGTGTACGAGGCCGAGCTGCGCGCCCAGCTC
GGGATCGAGCTCCCGTCGCCCGACGTGCAGCGCAGCGTGTCGCGCGGCAG
CACCGACTGCGGCAACGTGAGCTACCTCGTCGCGCCCACGATCCACTCGG
TGATTGATATCGGGTGCGAGGCCGAGATCACACGGACGAGTNTCTTGCTC
ACGCCAGACCGAGGAACGCACCACGTACGCTCGACCCATCGCGTGCTCGT
CATGTCGCGTACCGCTTCTGACGGAGCANAGCTCNCGAGCGCCACGCGCG
AGTCGCTCGCTAGCTGGCTCGCTCAGGCGGTAAACGCGTGCACGGCTGTA
CGATAAATCCTCCGCACTGTTTGACT
    




The gene BeE30N03D06 is related to E30-NOR-03-D06-U.AB1 ():

Sequence ID Image
E30-NOR-03-D06-U.AB1
No Image