Blastocladiella emersonii clone report

Clone ID BeE30N03A10
Best BLASTX Match gb|ABB43610.1|
Function Description oxidoreductases (related to aryl-alcohol dehydrogenases)-like [Thiomicrospira denitrificans ATCC 33889]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE30N03A10
TCTACACAAACCATGTATCGCACCATGCACTCGCTCGCGGCCACGCGTCG
CCGAGCCACTGCCGCCTTCGTCGCGCGAACCAGGCCACTCGCGGGCCGCG
CCATCCGCCCGCTCCTCGTATCGCCGCGGCGGACCGCGACGACGCTGTTC
GGCGGCGAGCCCGACGAGGAGTTTGGCGCGGCGGGCGACTTTGTCAACCG
GATCCCCAAGACGGGCCAGGTGATCTCGACGCTCGGGTTCGGCGCGTACC
GGATCAACGAGGCGACGCCCGACCACATGCGCGCGCTCGGCGACGCCGTG
AGCGCGGGCGTCAACGTGATTGACACGGCCGCGCACTTTGGCGACGGTGC
GAGCGAGCGCGCGGTCGGCGCCCTGCTCCGCGGTCCCGCTGCGCCCAAGC
GCGACAGCGTGTACCTGATCACGAAAGCCGGGTTCGTGACGCCGCACGTC
GCCGAGGAGCTGGCGCGCGCGGGCGTGAACCCGGACGCCGTGCACGCCGT
CGGGTCGGGCGCGGGCGCCGTCGGGCACACGGTGGATCCCGCCGCGATCA
AAGCGCAGCTCGACGGAAGTCTCGGCCGGCTCGGCGTGAATAGGTTGACC
TGTTCATGCTCAACTGCCCCGAGCGCATGCTCGCGGGCGGCATGACAGCC
GCGCA
    




The gene BeE30N03A10 is related to E30-NOR-03-A10-U.AB1 ():

Sequence ID Image
E30-NOR-03-A10-U.AB1
No Image