Blastocladiella emersonii clone report

Clone ID BeE30N03A06
Best BLASTX Match ref|XP_960597.1|
Function Description hypothetical protein [Neurospora crassa OR74A]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE30N03A06
CGATTCCCACTCGCTGCAACGCAACCGCACACGCACCATGAATAACATGA
ACATGGAGACGCTGCCAAAGGACAAGCGCGGGCTCCGCGCGTGCATGCTG
TGCTCGCTCGTCAAGAGCCAGACGCAGTTCCGCCGCGACGGGTGCGACAA
CTGCGAGGAGATTCTGAGGCTACGCGACCGCCCCGAGCGCGTCGGGTCGT
GCCCACGCAGTTCTTTGAGGGGACTATCGCGATGATGAACCCCGACCGGT
CGTGGGTCGCCAAGTGGCAGCGCGTGGACAGCCACGTCCCCGGCCTGTAC
GCGCTCAAGGTCAACGGCCGTCTGCCCGAGGAGATCGAGGACGAGCTGGA
GCGCCGCGGCATGCGGTACCGGCCACGCGACGGCACCGCCAACGACATGT
AGATGCAGTTTAATACACAATGCTCTTCNC
    




The gene BeE30N03A06 is related to E30-NOR-03-A06-U.AB1 ():

Sequence ID Image
E30-NOR-03-A06-U.AB1
No Image