Blastocladiella emersonii clone report

Clone ID BeE30N02H02
Best BLASTX Match ref|YP_325503.1|
Function Description Glutathione S-transferase-like [Anabaena variabilis ATCC 29413]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE30N02H02
GCGGGCGCGGCCCCGCCTCCCCGGCCAGCTAGCCAGACCCCATCGCTCAC
TGCTACGGATCACACACGCACCCACGCATCGACGACCATGACCGCCTCGA
CGGCCTTTGCCCCGCTCCGCCTCTTCACCTCCAAGGTGTGCCCGTTCGCG
CAGCGCGCCACCATCGCCGCGCACGAGCTCGGCTTCGTCGACTCGATCGC
CGAGGCCAAGTACAGCAACGGCGCCTTCGAGGTGGTCGAGATCGACCTCA
AAAACAAGCCCGAGTACTACACGCGCGACATCAACCCGCGCGGCAAGGTG
CCCGCGCTCGAGATCACCCACGCCGAGTCGGGTACCAAGGAGGTGCTCGT
CGAGTCGGCCCTGATCGCCGACTTCCTGCTGCAGGCCGCCGACTCGCCCG
CCACCCTCAACGGCAAGGCCCGCGCCCTCGACCGCTTCCGCGCCAACCTC
GTCGTCGACACGTTCAGCAACCAGGTCGTCGGCGCCTTCTACAACCTGCT
GCGCGAGAAGGACGCGGCCAAGCAGCCCGAGGCAACCGAGAAGCTGCTCG
AGGGCATCCGCGCCGTCCAGGCCTTCCTCTCGGCCGACGGGCCCTACGCG
CTCGGCGCCGAGTTCACCATCGCCGACATCCTGACCGCGCCCTTCCTCGC
CCGCTTCGTCGTCAACGAGCACTACCGCAACTTTGTCGTCCCCGACACCC
CCGAGTACGCGCGCTTTAACCGGTGGCGCGCCGNCCTCGCTGNCCGCCCC
TCGTCGTNGCACGACGCCGACAGGAGGTCTCTCGACGCTACGCGCTCGCG
CTGCGTGACGACTGTNCTGTGCCCGATCCAGTACCACTTATACCATTNTG
TTC
    




The gene BeE30N02H02 is related to E30-NOR-02-H02-U.AB1 ():

Sequence ID Image
E30-NOR-02-H02-U.AB1
No Image