Blastocladiella emersonii clone report

Clone ID BeE30N02E01
Best BLASTX Match ref|XP_363652.1|
Function Description hypothetical protein MG01578.4 [Magnaporthe grisea 70-15]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE30N02E01
ATCAGCCTCACACGGGCCTCCATGTAACTTGTTGCACTCAGCTCGACCAC
CGCACCACGCACTCTCGTCCCTCCACGTCGCGCTGCCATGTCTTCCAGCA
CCCCTCCACAACCGCCACCGGGCTCGGGCCTGGGTTCGGGCGCATCTCCG
CCCAACGTCCCCGCCGCACCACAATGTGAGCTCATGGACGGCTTCGCGAT
TGGCGTGCAGCTGCTCATGGGCTCGGCGGCGTTCCTGTCGCTGCTGTTCA
AGCGGCACCGCGAGTCGCCGCGGCGCCCGATGCGCGTGTGGCTGTGCGAC
GTGTCCAAGCAGGGCTTTGGCGCGTCGTTCGTGCACGGGCTCAACGTGCT
CGTGTCGCTCGTCGCGGGCGCCAACCCGGAGAGCCACTCGCAGAACCCGT
GCGTCTACTACTTCCTCAACGTGGGTATCGACACGACGGTCGGCGTCTAC
ATCCTGTTCCTGTGGCTGCGGCTCGCACACGGCGTCGTGGTGCGGCTCGG
CATCGAGCGCGACCTGCGGTCGGGCCACTACGGCGACCCGCCGCGGTTCC
TCGCGTGGCTCAAGCAGACGATCCTGTTCAGCTTCTGCCTCTTCATGATG
AAAGTGTGCGTCGCGCTCGCCATCTACCTGTTCCCGGTCCTCGAGTGGGT
CGGCAAGATTGCC
    




The gene BeE30N02E01 is related to E30-NOR-02-E01-U.AB1 ():

Sequence ID Image
E30-NOR-02-E01-U.AB1
No Image