Blastocladiella emersonii clone report

Clone ID BeE30N02B11
Best BLASTX Match ref|XP_759794.1|
Function Description hypothetical protein UM03647.1 [Ustilago maydis 521]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE30N02B11
CGAATTTTCGGCCCCATCCCCTTTGACGACGTGATTGCCTGAGTGATCGA
CTACCACCTCCGTCATGGCCAGCAAACGCACGACCCGCGTCTTCTCGGCC
GCCGAGGTCGCCAAGCACGCGACCGAGTCCGACTGCTGGATCACGCGCCG
CGGCAACGTCTACGACGTGACCGCCTTCATCGGCGACCACCCGGGCGGGC
CCGAGCTCATCACCGAGTACGCCGGCAAGGACATTGACGCCGTCATGCAC
GACGCCGACATCCACGACCACTCGGACGGCGCCTACGACATTCTCGACGA
CTACCTCATCGGCCGCCTCGAGTCGGCCTCCTCGGGCGACGGCGAGGACA
GCGGCGCCGACGTGTCCGACGACATCCCGTCAGCCAAGCGGTCCGCGCAG
TCCTCGGGGTTCGTGGACCCCGTCTCGGCGCTCGACGAGCAGCTCACCGA
GGAGCTGGCCTCGGCCAAGAAGCCGCTGCTCGACCTGTCCAAGCCGCTGC
TGTGGCAGATGCTCACGTCCACCTTCTCCAAGGACTACTACATGACCCAG
GTCCACATTGCGCGCCACCTGCCCGAGCCCGCCACCATCTTCGCCAACCC
GGTCCTCGAGATCTTCACGCGCACGCCGTGGTACCTGGTCCCGCTGTGCT
GGCTGCCCGTCGTCGCGTACCTCGCCTACGACGCGCACGTCTTCGGCGGC
ATGACCTTCCCCTCGCTCGCGGCGCACTACGCGTTCGGGCTCGGC
    




The gene BeE30N02B11 is related to E30-NOR-02-B11-U.AB1 ():

Sequence ID Image
E30-NOR-02-B11-U.AB1
No Image