Blastocladiella emersonii clone report

Clone ID BeE30N02B04
Best BLASTX Match ref|XP_661519.1|
Function Description hypothetical protein AN3915.2 [Aspergillus nidulans FGSC A4]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE30N02B04
CATCACTCCCGGTCCCTGCGCGCGCGCGATCCTATAAAGCTGCTGGCAGC
CCCCCGCGCACCCTCTCCTCTCTCCCGCTCCCAACCAACCTTCTTCCTCC
TCCCCCCTCAACCACCATCACCATGTCGTCCCCACAGCTGTCCGAGAAGC
CCGACATGGAGTCGCAGGCCACCAAGATCTCGGGTCTCCGCCGGCTGCAG
ATCCAGTACCGCGAGGAGCTGTCCGAGTTCTTCGGCACGCTTATCATGCT
GCTGTTCGGTCTCGGTGTCGTCGCCCAGACGGTGCTGTCCAAGGGCGCCG
CCGGCGACTCGCTGTCGATCCACATCTCGTGGTGCCTCGCCGTCGTCTTC
GGCATCTACTGCTCGGCGCCGTCCGGCGCGCACCTCAACCCGTCGGTGAC
GATCGGCCTCGCCGTGCACGGTGGCTTCGCCTGGTCCAAGGTCCCGCGGT
ACATTCTGGCGCAGATGCTCGGCGGCGTGGTCGCTGGCCTGCTCGTCTAC
ATCAACTACATTTCGGCGTTCAACGCGTACGACGGCGGCGTGCGCACGGT
GCCGCAGCGCGGCGACGCCGCGGCGGCCAAGATCGCGACCGCGGGCGTGT
TCGCGACGTACCCGGCCGACTACCTGAACATCCNCGGCATGTTCTTCTCC
GAGTTCTTTGCCACCATGCTCCTGTTCATCGGCATCCTGGCCATCGGCGA
AG
    




The gene BeE30N02B04 is related to E30-NOR-02-B04-U.AB1 ():

Sequence ID Image
E30-NOR-02-B04-U.AB1
No Image