Blastocladiella emersonii clone report

Clone ID BeE30N02B01
Best BLASTX Match gb|AAB61599.1|
Function Description 2-isopropylmalate synthase [Lycopersicon pennellii]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE30N02B01
CACGGATCCGACGCCGACGACGGCGAGCTCGCGCACGCGGCGGCCAAGGA
GCACCTGTACATCTTCGACTCGACGCTGCGCGACGGCGAGCAGAGTCCCG
GGGTCACGCTGCACGTCACCGAGAAGGTGGAGATTGCGCGGCAGCTGTCC
AAGCTGGGCGTCGACATCTGCGAGGCCGGGTTCCCGATCGCGTCCGACGG
CGACTTTGAGGCCGTGGCCCGCATCGCGCGCGAGGTCGGCCCGCTCATGG
TCAACCGCGAGCGCATCGGCCGCCCCATGCGCATCTGCGGCCTGGCCCGC
GCGACGCGCGGCGACATCCAGCGCGCCTACGACGCCGTCCACCACGCGCC
GCTGCACCGGATCCACACGTTTCTGGCGACGAGCGACATCCACCTCGAGC
ACAAGCTGCGCATCTCGCGCGACGAGTGCGTGCGCCGCGCCACCGAGGCC
GTCGCCTTCGCGCGCTCGCTCGTCGACGACGTCGAGTTCTCGCCCGAGGA
CGCGGGCCGGTCCGACCCCGACTTTCTGTGCCGCGTGCTCGGCGCCGTGA
TCGACGCGGGCGCCACGGTCCTCAACATCCCCGACACGGTCGGGTACAAC
ACGCCCGAGGACTACAGCCGGCTCATCGCGTACCTGATCGCGCACACGCC
CGGCGCCGGCANAGTGATCTGGTCGACGCACTGCCACAACGACCTCGGGC
TCGCCACCGNCAACACGCACGCCCGCGAAGACTTCAGGGACCCGCACGAC
GACGAGTGGATGAAGCCACGCTCTCGTACACGACGAGTGACCCGCGAGAC
CAGCTCAGTACCGCGCGTCGTTAGACTACCTCGACGCACCGATGCAGCCG
TGCCCCGCCAGCCGTTACTAGTGATCGTGTGAGATGCTTACCACCACACA
TATACGTTCTACCCCC
    




The gene BeE30N02B01 is related to E30-NOR-02-B01-U.AB1 ():

Sequence ID Image
E30-NOR-02-B01-U.AB1
No Image