Blastocladiella emersonii clone report

Clone ID BeE30N01E04
Best BLASTX Match ref|XP_381709.1|
Function Description hypothetical protein FG01533.1 [Gibberella zeae PH-1]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE30N01E04
GGCGTCGCTCGCGCAGGCCACGTTCCTCGTGCTAGTCCTCGTCACGACGG
TCGTCACGGGCACCGTGTTCGCGCTCGTCACGTACCTGCAGAGCGACCAC
ATCGAGCTCACGATCCGCGTGCTGCAGCTCGCGACGCACGTCCTGCGCAA
CAACCCGACCATCTTCGGGCTCTCGCTCGGCCTGCTCCTCGCGTCGCTCG
TGTTCGTGGTCCTGTGGATCGCGACGGTCGCGCGGTTCATTGCCCTGACC
GCAGGCCTCCTCGCGCTCGCCGGGTCGCCCTCCATCGCCGACCCCGCGGT
CGTCCTTGAGTCGTGGGTCCTCGGGTTGCACTGGACCCCGACGCTGCTCT
TCTACACGGTGATGCTGGTGTGGACGACGCAGGTGATCGCGGCGGTCCAC
CGCATGGCCATCGCGTGCATCGTCCACCACTGGTACTTTTCGCGCCACGC
GTCGCGGCTGTCGGGCACCGAGCGCGCGCGCCGCGCCCTGCACCGCGCCG
CCACGGTCCTCATCGGCACCGCGTGCGCCGGCGGACTCGTCGTCACGGTG
ATCCGCGCGGCGCAGTTCGCCCACCGCGTGTACCGGCGCCAGATCCGGCC
GCGGATCATGGGGGCGACGACCACGGCGCGC
    




The gene BeE30N01E04 is related to E30-NOR-01-E04-U.AB1 ():

Sequence ID Image
E30-NOR-01-E04-U.AB1
No Image