Blastocladiella emersonii clone report

Clone ID BeE30N01D07
Best BLASTX Match gb|AAW44038.1|
Function Description ketol-acid reductoisomerase, putative [Cryptococcus neoformans var. neoformans JEC21]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE30N01D07
ACCCAACGCTCGCTCGCTTGCGTCATCCACTACCCCACTACCACCGTCAG
CAACATGATCTCCTCCGCCTGCCGCACCGCCCTGCGCGCCGCGACCCGCA
CCACCGTGTCGCGCGCCGTGCCCCGTGCCGCCGCGACCGCCGCCCTGCGC
GCCACCGCGTCCGCGACCGCCATGACGATGCCGCAGCGCCGCGGCATCCA
GACGCTCGACTTTGGCGGCACCAAGGAGGTGGTCTACGAGCGCTCCGACT
ACCCGCGCGAGAAGCTGCACCAGGTCCTCGGCAAGGACGTGCTCGCCGTT
GTCGGCTACGGCACCCAGGGCCGCGCCCAGTCGCTCAACGCGCGCGACAA
CGGGCTCAACGTGATTGTCGGCGTGCGCGAGGGCGGCCACTCGTGGAAGC
TCGCCCAGGAGGACGGCTGGGTCCCCGGCAAGACGCTGGTCGACATTGAC
ACGGCGTGCCAGCGCGGCACCATCGTCATGAACCTGCTGTCGGACGCGGG
CCAGAAGGAAGCGTGGCCGGCCATGCAGAAGCACATCACCAAGGGCAAGA
CGCTCTACTTCTCGCACGGCTTCGGCGTCGTGTACAAGGACCAGACGGGC
ATCGTGCCGCCCAAGGACGTGGACGTGATCCTGGCCGCGCCCAAGGGCTC
GGGCACCACGGTCCGCTCGCTGTTCCTCGA
    




The gene BeE30N01D07 is related to E30-NOR-01-D07-U.AB1 ():

Sequence ID Image
E30-NOR-01-D07-U.AB1
No Image