Blastocladiella emersonii clone report

Clone ID BeE30N01C07
Best BLASTX Match gb|AAH82408.1|
Function Description MGC82051 protein [Xenopus laevis]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE30N01C07
CGTAAACCCATGAATCACATCTAAACCATGTCAGACTTGCTGCAACCCGC
CCAGAGTCTCGTCCCCTTTGCCTTTGACCAGTGGTACCCGCTCTTCCGCA
AGGAGACGGTCCGCTCCGTCGTCATCGACCTCCCCGACGACTACGTCGCC
TACCTGCACGCCGACGGCATCGCTCTCGCCGGCGACGACGTCCTCTACTC
GTACCATGACGAGGTCGACACGGACGCCCTCGAGGACACGCACAACGACG
GGTCCGACGCCGAGGATGCTGACAGCGAGGATGCTGAGGCCCACGTCCCC
GAATTCCCCGCACTCGAGTCCGCCGTCGCCACCGCCATCGCTTCGCTCGG
CGGCGCCGTGTTCCCGAAACTCAACTGGTCGAGTCCGCGCGACGCAGCGT
GGATCGCGCTCGACGGGTCGCTCAAGTGCACGTCGCTGCGCGACATCACG
CTGCTGCTCAAGGCGAGCGATTTCGTCGTGCACGACCTCGACCACCCGGA
CAACGCGCGCCCGAAACTCGTGCTGCGCAAGTGGGCGCCGCTGCACCCGG
GCCTCGAGTTCCGCTGCTGGGTCTACGGCCGCGAGATCGTCGCCATCTCG
CAGCGCGACGTGTCCCACTTCTACGAGTTCCTTGTCGCTGAGCGCGATGA
GCTGAGTGCGATTATTCACGATTACTTTGAGGACGTGGTCCGCGACGTGT
TCCCGCTCGAGACGTACG
    




The gene BeE30N01C07 is related to E30-NOR-01-C07-U.AB1 ():

Sequence ID Image
E30-NOR-01-C07-U.AB1
No Image