Blastocladiella emersonii clone report

Clone ID BeE120N38G12
Best BLASTX Match gb|AAM73860.1|
Function Description putative serine/threonine protein kinase; HcSTK [Haemonchus contortus]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE120N38G12
CCGACGCCATGATATCATCGTCGATGGGGACACCGCCACCGGAGCATCTC
GATACATTCGCCCGACCGCGGGCTAGCACCGAGCATGAAGCACATGATGT
ATCTCTTGATCTGGCAGGGTCAGAGAAAGCGACCCTCGTCCCGCCGCCAG
ATGTGATCTCGAGCAAGCACCCCGAGATCCCGGGCTACACGATCCAGCGG
ATCATCGGCCGCGGCAGCTTCGGCATCGTGTACCTCGCCAGCCATGCAGC
ATCCGGGACGCAGGTAGCCATCAAGTCGCTCGACAAGCTGCGCCGCCGCC
CGCGCGCCTCGTCCGTGAGCAACTTCACGGCCGAGTGCGACCTGCTGCTG
AGTCTGCAGCACGCGGCGCGGCACCCGAACATCATCGCCGTGTACGAGGC
CGTCGACGAC
    




The gene BeE120N38G12 is related to E120-NOR-38-G12-U.AB1 ():

Sequence ID Image
E120-NOR-38-G12-U.AB1
No Image