Blastocladiella emersonii clone report

Clone ID BeE120N38F02
Best BLASTX Match ref|XP_786243.1|
Function Description PREDICTED: similar to CG5851-PA [Strongylocentrotus purpuratus]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE120N38F02
CATGACCGAGGCCGGTCTCGAGGACCCTCTTCCGCTCGCGCGGTTCAACC
AGCTGGAAGAAGTCTCGCTGGCCAGCAACCCGATCCACGACCTCGAGGCC
GTCGCCGTCGTCCTCTCCGTCTGCCCGCGCGTCCACTCGCTCGACCTGTC
CGGGTGCCCGGCCGCCGCGGGCCCGCGGGCGCGCGAGAAGCTCGTGCTGG
TCCATCCTGAGCTCGACATCCTCAACGGCCGCGAGATCAGCCCCGTCGAA
AAGGCGTTCCTGTTCAACTGGCAGCGGCACCGACACCAGGGCGCGCGGCA
CCGGTCTTCCCCCGGGGACGAGGCCGCCGCGCCATCGTCATCGTCCGGCG
TGCCGAGCCTGCCGCCCATCGACGGCGT
    




The gene BeE120N38F02 is related to E120-NOR-38-F02-U.AB1 ():

Sequence ID Image
E120-NOR-38-F02-U.AB1
No Image