Blastocladiella emersonii clone report

Clone ID BeE120N38E06
Best BLASTX Match ref|NP_999823.1|
Function Description kinesin II-accessory 115 kDa polypeptide [Strongylocentrotus purpuratus]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE120N38E06
CGAGTGGCGCAACGAGATGATGCGCATGGGCCTGGTCGCGCACCTCGTGG
ACGTGCTGCACCGCGACGACGAGACGAGCCCGGAGCTCCTCCTCCTCCTC
TACCAGATCAGCTGCGACGAGCGGTCCAAGGCCATCTTCACGTACACGGA
CGCGCTGCCGCAGGTCATGAAGCTGATCCTCAAGTACCCGCGCGACCACG
TGTCGGTCGAGCTCATGACGCTGGCCATCAACCTGGCCGTCAACGAGCAC
AACGCCGAGGTGTTTGCCGAGAACGGCGGGCTCAAGTTCCTCGTGAAACG
GCTCGTCCTGACCCGCGACTACCTGCTGCTCAAGATGCTCCGCAACATGA
GCGCCCACGCCGCCCTGCACCTCGCGTTCCTCGACCATATCGACGACCTC
ATGGCGCTCTTCGTCGCGTCCACGTCGCGCGACGTGCACGTCGAGGTGCT
GGGTCTGCTCGCCAACCTGCGCGTACCAGACATGGACTACGCGAAACTCG
CCGCCGCGTACAACCTCGTGCCGTACATCGCCGCGCGCCTCGCGGCCGTC
CGCGCCGAGGACACGCTGGCCCTCCCGGGCACGACCGCCGTGATGCCCAA
GGCGTCGCCGGACGACGACCTCGCGCTCGAAGTCGTCCAGCTCGTCGCCA
CGCTCGCGCTCGACGACGCCATGGGCGAGCCGCTC
    




The gene BeE120N38E06 is related to E120-NOR-38-E06-U.AB1 ():

Sequence ID Image
E120-NOR-38-E06-U.AB1
No Image