Blastocladiella emersonii clone report

Clone ID BeE120N38D09
Best BLASTX Match ref|XP_969796.1|
Function Description PREDICTED: similar to Protein C17orf39 homolog [Tribolium castaneum]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE120N38D09
GGCACGCTGCACGTCGGCGCCGAGTTTGAGGGGTTCCAGCAGTCCAACGA
TTGTCAGTACAAGGTCAAGGTGACGGTTCAGAACGTGGACCTGCACACGT
CGCACATGTCGGGCTTCCTCGAGATCCACGGCCTGACGGACGCGCAGCCG
GAGATCACGACGTACTTTGACGGCGAGCTGATCGGCCCACGGTACTCGTT
CCTGACGCGGGCGTGGGACGCGGACGAGGCCACGGACCGCGCGCACTGGG
ACAAGTTCCCGGAGTTTGCGGCGTTTGCCGAGCGGTTCAACGCGGACGGG
TTCGCGCTGCCGAACCCGGGCTCGAGCGAGGCGCGCGAGAGCGGCGACGT
GGTCTTCATGCGGTGGAAGGAGCGGTTCCTGGTGCCCGACCACCGGCAGA
CGACGGTCGAGGGCGCCTCGTTCAGCGGGTTCTACTATGTCGCCATGAAC
GTGCGCACGGGGACGCTGACGGGGTACTACTTCCACGTCATGTCGGCGTG
GTTCCAGCGGCTCGACCTCGAGTACACGGGCGTGCTCGGGTTCCCGAGCT
TTGAGATGCGGTAGCCGTCGCGTCGCGTCAGTTTTTGTCCCACCACCAAC
CGTAGTTGCACCTTCATCTGTAATGTAAATGAACTGTATTGCATCCACCC
GNNG
    




The gene BeE120N38D09 is related to E120-NOR-38-D09-U.AB1 ():

Sequence ID Image
E120-NOR-38-D09-U.AB1
No Image