Blastocladiella emersonii clone report

Clone ID BeE120N38D06
Best BLASTX Match ref|XP_818837.1|
Function Description hypothetical protein [Trypanosoma cruzi strain CL Brener]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE120N38D06
CGTCAACCTCGTCATCGGCACCCTGTACTGCGCCAAGGGCAACTTCGAGT
TCGGCATCGGCCGCGTCATGAAGTCCATGGACCCCATGGCCCGCAAGCTC
GGCACCGACACGTGGTACTACGCGAAGCGCTGCTTCGTCGCGCTGTTCGA
GACCCTCGCCAAGCAGATGATCGTGCTCAAGGACGACGTGTACCACGAGA
TCCTCGCCTTCTTCGACACGGCCGAGAGCCACGGCCGCGACATTCTCGCC
GTCGTCGACCCCATGGGCATGGCCAACATTGACCCCGCCCACAACTCGGT
CGCGTACGAGGCGCGCATGCTCAAGGCGCTGTACCTCAAGCTGTACCAGT
GATGGACGATGATGAACAAAAACGGACTGCAACTATTT
    




The gene BeE120N38D06 is related to E120-NOR-38-D06-U.AB1 ():

Sequence ID Image
E120-NOR-38-D06-U.AB1
No Image