Blastocladiella emersonii clone report

Clone ID BeE120N37F12
Best BLASTX Match ref|XP_794287.1|
Function Description PREDICTED: similar to armadillo repeat containing 4 [Strongylocentrotus purpuratus]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE120N37F12
CCGCGCTCGACGCTGAGAGCATGGGCATCATCGACCGCCTTGACGGCGTC
CGGCTGCTGTGGTCGCTGCTCAAGTCGCCCAACCCGGCGGTCCAGGCGTC
GGCCGCTTGGGCCATCTCGCCGTGCATCGAGAACGCCAAGGACGCGGGCG
AGATGGTCCGCTCGTTCGTCGGCGGACTGGAGCTGATCGTGTCGCTGCTC
AAGTCGGACCACGTCGAGGTGCTTGCGTCCGTGTGCGCGGCGATCGCGCA
GATCTCAAAGGACGAGGAAAACCTGGCCGTGATCACGGACCACGGCGTGG
TCCCGATGCTGGCCAAGCTGACGCAGACGCGGCACGACCGCCTGCGCAAG
CACCTGAGCGAGGCCATTGCGCGGTGCTGCCACTGGGGGAACAACCGGAT
CGCGTTCGGCGCGGCCGGCGCCGTCGCGCCGCTCGTCAAGTACCTCAAGA
GCCCCGACCCCGAGGTCCACCGGTCGACCGCGCAGGCGCTGCACCAGCTC
AGCAAGGACCCCGACAACTGCGTCACGATGCACGAGCACGGCGTCGTGCA
GCTGCTCCTGGGCATGGTCGGGTCCTCGGACACGGTCCTGCAGGA
    




The gene BeE120N37F12 is related to E120-NOR-37-F12-U.AB1 ():

Sequence ID Image
E120-NOR-37-F12-U.AB1
No Image