Blastocladiella emersonii clone report

Clone ID BeE120N37F07
Best BLASTX Match gb|EAR89726.1|
Function Description hypothetical protein TTHERM_00974270 [Tetrahymena thermophila SB210]



The following sequence was assigned to this function:

Sequence ID Sequence
BeE120N37F07
CGGATCCAAACTCTGCTCCCCTCGCAATTCCACCTCTTGCACTCACGCGC
ACTCGCTGCAACACTCCCCCATGAACCGACCCGCTGCGCCGAAAATGAAC
AAATCCGGGCGCGGCAGCGCCAAGGCGACGGCCGTGACGACGTACGGCGC
CGACTTTGGGCGGCCGACGTCGACCAAGGCGCAGCCCAACACGCTGCTCG
TCAAGTACCCGGTCGGCAAGGCCAAGCCGTCGTCGTACACGCTGCCGCCC
AACGAGCACGTGTACGGGCGCGGCGTTGACCGCAAGCCCGACGAGACCAC
GGCCAAGGTCCTGTCCAACTGGCAGACCAAGCAAAAGTCGAAGAACGCGG
AACCGGCGCTCGACTACGTGGCCATGAACAAGCAGTGCATCCACGAGGGG
ATCGTGGACCCGCGCGCGCAGTACGAGCACCGCAAGACGCACCCGATCCG
CGTCAAGGTGATTGACCACAGCACGCCGGGCCGCCGCGCGCTGCGCCGGC
TGCCGAGCGACACCGACCCGCTCTTCACCTACGGCAAGCCGACGCGCCCG
TCGTCGCCCGTCGCCAAGCTCATGTCCGACCACTACGAGCGCGAGTACAT
GGCCATGCTCGAGGCCGAGCGCGCGCGCGCCGACGCCGNGGNGGCGGCGT
CAGGTTCGCACGCGAACCGN
    




The gene BeE120N37F07 is related to E120-NOR-37-F07-U.AB1 ():

Sequence ID Image
E120-NOR-37-F07-U.AB1
No Image