Blastocladiella emersonii clone report

Clone ID BeE120N37E02
Best BLASTX Match  
Function Description  



The following sequence was assigned to this function:

Sequence ID Sequence
BeE120N37E02
CAACGTGGAGCTGACTGACGCCGAGCGCGCGTCGTCGTCGGCCGCTACCT
CGACCACGGTGACGACGGTCCAGACCATGGCCAAGGGCAAGGGCGGCAAG
AAGCAGGCCAACGCC
    




The gene BeE120N37E02 is related to E120-NOR-37-E02-U.AB1 ():

Sequence ID Image
E120-NOR-37-E02-U.AB1
No Image